Regions on adenylyl cyclase that are necessary for inhibition of activity by bg and Gia subunits of heterotrimeric G proteins

The two large cytoplasmic domains (C1 and C2) of adenylyl cyclases (AC), when expressed separately and mixed together, reconstitute enzyme activity that can be regulated by various modulators. Therefore, we have used the C1 or its C1a subdomain and C2 regions from type I AC (ACI) and type V AC (ACV) to identify the region on ACI that interacts with bg subunits of heterotrimeric G proteins. In addition, we also used a chimeric C1 domain (VC1aIC1b) in which the C1a region was derived from ACV and the C1b region was from ACI. By mixing the C1 or C1a or VC1aIC1b domains with C2 regions of ACI or ACV, we have shown that the C1a region (amino acids 236–471) of ACI is sufficient to observe bg-mediated inhibition of enzyme activity, which is stimulated by either constitutively active Gsa (Gsa*) or Ca21y calmodulin (CaM). Although the C1b region and C2 domain of ACI were by themselves not sufficient for inhibition of activity by bg subunits, the presence of both of these regions formed another bg interaction site that was sufficient to observe Gsa*or Ca21yCaM-stimulated activity. Inhibition of AC activity attributable to interaction of bg subunits at either of the two sites was blocked by a peptide (QEHA) that has previously been shown to inhibit the effects of bg on various effectors. Moreover, the C1 region of ACI was sufficient to observe Gia1-elicited inhibition of Ca21yCaM-stimulated activity. Although the C1a region of ACV was sufficient for inhibition of activity by Gia1, the presence of C1b region from either ACI or ACV increased sensitivity to inhibition by the inhibitory G protein. Thus, the inhibitory inf luences of Gia1 are mediated on the C1 regions of both ACI and ACV. The effects of bg on ACI can be mediated by interactions with the C1a region and a bg interacting site formed by the C1b and C2 domains of this enzyme. Mammalian adenylyl cyclases (ACs) that catalyze the conversion of ATP to cAMP can be divided into membrane-bound and cytosolic forms (1–3). The recently characterized mammalian cytosolic AC is not regulated by heterotrimeric G proteins or forskolin (3). On the other hand, the membrane bound mammalian ACs are regulated not only by G protein a-subunits and forskolin but also by bg subunits of heterotrimeric G proteins and other modulators such as Ca21 and Ca21ycalmodulin (see refs. 1 and 2 for reviews). To date, nine distinct forms (types I–IX; ACI–ACIX) of membrane-bound adenylyl cyclases have been cloned and characterized (see refs. 1 and 2 for reviews). In addition, two splice variants of type VIII isoform have been reported (4). Although the nine membrane-bound forms of AC share considerable sequence homology, the various modulators regulate their activity differently. Thus, type I, III, and VIII isoforms are stimulated by Ca21ycalmodulin (4–8). The closely related type V and VI forms of AC are inhibited by low concentrations of calcium without the involvement of calmodulin (9–12). Similarly, although Gia (the inhibitory GTP binding protein of AC) inhibits type V and VI ACs, it does not alter the activity of type II enzyme (see ref. 1 and 2 for reviews). On the other hand, the bg subunits of heterotrimeric G proteins conditionally stimulate type II and IV ACs, provided that active Gsa (the stimulatory GTP binding protein of AC) is present (13–15). However, bg subunits inhibit the activity of type I adenylyl cyclase (5, 13, 15). Because the full-length ACs cannot be expressed in large amounts and because large scale purification of these enzymes is problematic, several groups have expressed the two large cytosolic domains (C1 and C2) of AC in bacteria and have used these to study regulation of the enzyme (16–20). Mixtures of C1 and C2 domains of AC have been shown to reconstitute enzyme activity that can be regulated by G protein a subunits, forskolin, and Ca21 in a manner similar to the full-length enzyme (16–20). Therefore, using the C1 and C2 domains from type I and V ACs (ACI and ACV)‡, as well as a chimeric C1 region derived from these enzyme, we have identified the regions on ACI and ACV that are involved in the inhibition of enzyme activity by bg and Gia subunits, respectively. Our data demonstrate that the C1a region (amino acids 236–471) of ACI is sufficient to observe bg-mediated inhibition of enzyme activity. Additionally, we demonstrate that, although neither the C1b (amino acids 472–607) nor the C2 (amino acids 809-1133) regions of ACI by themselves are sufficient to observe inhibition of enzyme activity by bg subunits, when present together, these regions are also sufficient to form a bg interacting site. Concerning inhibition of AC activity by the type 1 isoform of Gia (Gia1), our data show that the C1a region of ACV (amino acids 322–571) and C1 region of ACI (amino acids 236–607) are sufficient to observe inhibition of enzyme activity by the G protein. Moreover, when C1b regions of ACI or ACV are connected to the C1a region (amino acids 322–571) of ACV, sensitivity to inhibition by Gia1 is augmented. MATERIALS AND METHODS Plasmid Construction. The vector pTrcHisB (Invitrogen) was used for expression of the soluble forms of canine ACV and bovine ACI subunits in Escherichia coli. Plasmid construction of the recombinant forms of ACV subunits was performed as described (17, 18). cDNAs encoding the C1a (IC1a; amino acids 236–471), C1 (IC1; amino acids 236–607), and C2 (IC2; amino acids 809-1133) regions of ACI were obtained by PCR using ACI cDNA as template and the following primers: IC1a, primer A: 59 ATAATATGGATCCGGCTGAGCGCGCCCAG 39, primer B: 59 ATATATAGCGCTATGAGTTTTCAGAAAACTGTTCCTCTC 39; IC1, primer C: 59 ATATATGGATCCGGCTGAGCGCGCCCAG 39, primer D: 59 ATAThe publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked ‘‘advertisement’’ in accordance with 18 U.S.C. §1734 solely to indicate this fact. PNAS is available online at www.pnas.org. Abbreviations: AC, adenylyl cyclase; ACI, type I AC; ACV, type V AC; GDPbS, guanosine 59-O-(2-thiodiphosphate); CaM, calmodulin. †To whom reprint requests should be addressed. E-mail: tpatel@ physio1.utmem.edu. ‡For explanation of abbreviations of ACI and ACV domains, see Fig. 1.